2022-1: Counting DNA Nucleotides?
This problem was inspired by Counting DNA Nucleotides found on the excellent bioinformatics website rosalind.info.
Write a function that:
- takes a right argument that is a character vector or scalar representing a DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T').
- returns a 4-element numeric vector containing the counts of each symbol 'A', 'C', 'G', and 'T' respectively.
Hint: The key operator f⌸ or the outer product operator ∘.g could be helpful.
Examples:
(your_function) 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
20 12 17 21
(your_function) ''
0 0 0 0
(your_function) 'G'
0 0 1 0
your_function ←
Solutions
